Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU110021

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ji-Young Jang et al.
Experimental & molecular medicine, 45, e3-e3 (2013-01-12)
MicroRNAs (miRNAs) participate in diverse biological functions and carcinogenesis by inhibiting specific gene expression. We previously reported that suppression of adenine nucleotide translocase 2 (ANT2) by using the short hairpin RNA (shRNA) approach has an antitumor effect in several cancer
Yun Choi et al.
BMC cancer, 13, 143-143 (2013-03-26)
It is important to simultaneously induce strong cell death and antitumor immunity in cancer patients for successful cancer treatment. Here, we investigated the cytotoxic and phenotypic modulation effects of the combination of ANT2 shRNA and human sodium iodide symporter (hNIS)
Linh Ho et al.
Aging, 5(11), 835-849 (2013-12-04)
Efficient coupling of cellular energy production to metabolic demand is crucial to maintain organismal homeostasis. Here, we report that the mitochondrial Sirtuin Sirt4 regulates mitochondrial ATP homeostasis. We find that Sirt4 affects mitochondrial uncoupling via the adenine nucleotide translocator 2
Ji-Young Jang et al.
Breast cancer research : BCR, 10(1), R11-R11 (2008-02-13)
Adenine nucleotide translocator (ANT) 2 is highly expressed in proliferative cells, and ANT2 induction in cancer cells is known to be directly associated with glycolytic metabolisms and carcinogenesis. In addition, ANT2 repression results in the growth arrest of human cells
Ji-Young Jang et al.
Molecular cancer, 9, 262-262 (2010-09-30)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL; apo2 ligand) induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica