Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU109721

Sigma-Aldrich

MISSION® esiRNA

targeting human UBA2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGTAGCACCAGATGTCCAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCTAATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGATGACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAGGACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAAGATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACAGCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAATGCCGACGTCAGTGAAGAAGAGAGAAGCCGCAA

Ensembl | Número de adesão de ser humano

ENSG00000126261

nº de adesão NCBI

NM_005499

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UBA2(10054) , UBA2(10054)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Biying Jiang et al.
Journal of cellular biochemistry, 120(8), 12752-12761 (2019-03-09)
Ubiquitin activating enzyme 2 (UBA2) is a basic component of E1-activating enzyme in the SUMOylation system. Expression and function of UBA2 in human cancers are largely unknown. In this study we investigate UBA2 expression the function in human non-small-cell lung
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Xiaoke Liu et al.
Journal of hematology & oncology, 8, 67-67 (2015-06-13)
SUMO-activating enzyme subunit 2 (SAE2) is the sole E1-activating enzyme required for numerous important protein SUMOylation, abnormal of which is associated with carcinogenesis. SAE2 inactivation was recently reported to be a therapeutic strategy in cancers with Myc overexpression. However, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica