Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU109701

Sigma-Aldrich

MISSION® esiRNA

targeting human HSP90B1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAG

Ensembl | Número de adesão de ser humano

ENSG00000166598

nº de adesão NCBI

NM_003299

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HSP90B1(7184) , HSP90B1(7184)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XPS
RZR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pedro Buc Calderon et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 115-120 (2018-06-01)
Grp94 plays an essential role in protein assembly. We previously suggested that Grp94 overexpression is involved in tumor aggressiveness. However, the underlying mechanisms remain unknown. Since many tumors display high Grp94 levels, we investigated the effects of tumor microenvironment on
Qun Wei et al.
Biochemical and biophysical research communications, 511(1), 92-98 (2019-02-17)
Vascular endothelial cell (VEC) apoptosis takes part in the development of various cardiovascular diseases. Heat shock protein 90 (HSP90) regulates apoptosis through various apoptosis associated client proteins. In previous study, we identified a novel HSP90 inhibitor HCP1 induced apoptosis in
Naiara Santana-Codina et al.
International journal of molecular sciences, 20(16) (2019-08-10)
Metabolic adaptation may happen in response to the pressure exerted by the microenvironment and is a key step in survival of metastatic cells. Brain metastasis occurs as a consequence of the systemic dissemination of tumor cells, a fact that correlates
Sha She et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 741-752 (2018-07-20)
C reactive protein (CRP) levels are elevated in many diseases, including malignant tumors and cardiovascular disorders. In this study, the protein interaction network for CRP was evaluated to determine the importance of CRP and its interacting proteins in the molecular
Lipeng Xiong et al.
Journal of proteomics, 182, 34-44 (2018-05-08)
A Disintegrin And Metalloproteinase 12 (ADAM12) is highly expressed in multiple cancers such as breast and cervical cancers and its high expression reduces the overall patient survival rate. ADAM12 has two major splicing variants, the long membrane-anchored form ADAM12L and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica