Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU107711

Sigma-Aldrich

MISSION® esiRNA

targeting human SNW1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAAGACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCAGTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTCAGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGAAATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCCCGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGACTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAATGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGACTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA

Ensembl | Número de adesão de ser humano

ENSG00000100603

nº de adesão NCBI

NM_012245

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SNW1(22938) , SNW1(22938)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qiao Zhang et al.
Microbes and infection, 22(10), 576-584 (2020-08-18)
The Ski-interacting protein (SNW1) acts as a transcriptional co-regulator associated with mRNA splicing and transcription, cell cycle progression, acute and chronic inflammatory responses, however, its role involved in host antiviral innate immune responses remains to be explored. Here, for the
Shusen Zhang et al.
Molecular and cellular biochemistry, 410(1-2), 1-9 (2015-08-12)
SYF2, also known as p29/NTC31/CBPIN, encodes a nuclear protein that interacts with Cyclin D-type binding-protein 1. SYF2 has been reported to be involved in pre-mRNA splicing and cell cycle regulation. In the present study, we observed that SYF2 was obviously
E M Davies et al.
Oncogene, 34(28), 3711-3727 (2014-09-23)
Glioblastoma is the most common and lethal primary malignant brain tumor in adults. The tumor suppressor gene PTEN is deleted, mutated or hypermethylated in more than 60% of glioblastoma cases resulting in hyperactivation of the phosphoinositide 3-kinase pathway, which leads

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica