Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU106991

Sigma-Aldrich

MISSION® esiRNA

targeting human UQCRFS1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAAATTGAGCAGGAAGCTGCAGTTGAATTATCACAGTTGAGGGACCCACAGCATGATCTAGATCGAGTAAAGAAACCTGAATGGGTTATCCTGATAGGTGTTTGCACTCATCTTGGCTGTGTACCCATTGCAAATGCAGGAGATTTTGGTGGTTATTACTGCCCTTGCCATGGGTCACACTATGATGCATCTGGCAGGATCAGATTGGGTCCTGCTCCTCTCAACCTTGAAGTCCCCACGTATGAGTTCACCAGTGACGATATGGTGATTGTTGGTTAAGAGACTTGGACTCAAGTCATAGGCTTCTTTCAGTCTTTATGTCACCTCAGGAGACTTATTTGAGAGGAAGCCTTCTGTACTTGAAGTTGATTTGAAATATGTAAGAATTGATGATGTATTTGCAAACATTAATGTGAAATAAATTGAATTTAATGTTGAATACTTTCAGGCATTCACTTAATAAAGACACTGTTAAGCACTGTTATGCTCAGTCATACACGCGAAA

Ensembl | Número de adesão de ser humano

ENSG00000169021

nº de adesão NCBI

NM_006003

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UQCRFS1(7386) , UQCRFS1(7386)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhao Yang et al.
Antioxidants & redox signaling, 32(7), 447-462 (2019-08-29)
Aims: It is known that mitochondrial reactive oxygen species generation ([ROS]m) causes the release of Ca2+via ryanodine receptor-2 (RyR2)
Lin Mei et al.
Nature communications, 11(1), 3527-3527 (2020-07-17)
Ca2+ signaling in pulmonary arterial smooth muscle cells (PASMCs) plays an important role in pulmonary hypertension (PH). However, the underlying specific ion channel mechanisms remain largely unknown. Here, we report ryanodine receptor (RyR) channel activity and Ca2+ release both are
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica