Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU106111

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT17

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGA

Ensembl | Número de adesão de ser humano

ENSG00000186831

nº de adesão NCBI

NM_000422

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KRT17(3872) , KRT17(3872)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chun-Ying Xiao et al.
Chinese medical journal, 133(24), 2910-2918 (2020-11-26)
Psoriasis is a common chronic inflammatory skin disease with 2% to 3% prevalence worldwide and a heavy social-psychological burden for patients and their families. As the exact pathogenesis of psoriasis is still unknown, the current treatment is far from satisfactory.
Mihaela Chivu-Economescu et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(6), 948-959 (2017-03-17)
Keratin 17 (KRT17) was shown to be an important molecular marker for predicting the carcinogenesis, progression, and prognosis of various cancer types. Our previous studies identified KRT17 as a possible biomarker for gastric cancer by gene microarray, with an elevated
Hui Liu et al.
Gene, 563(1), 35-40 (2015-03-10)
Hereditary protein C deficiency (PCD) is an autosomal inherited disorder associated with high risk for venous thromboembolism (VTE). This study aimed to explore the functional consequences of two missense mutations, p.Asp297His and p.Val420Ile, responsible for type I/II PCD and recurrent
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica