Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU100711

Sigma-Aldrich

MISSION® esiRNA

targeting human TGM2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Robin Delaine-Smith et al.
Cancers, 11(5) (2019-05-24)
Colorectal cancer is the third most common cancer worldwide, and the fourth leading cause of malignancy-related mortality. This highlights the need to understand the processes driving this disease in order to develop new treatments and improve patient outcomes. A potential
Yesim Bagatur et al.
Cell adhesion & migration, 12(2), 138-151 (2017-05-13)
Tissue transglutaminase (TG2) is the ubiquitously expressed member of transglutaminase family and shown to play a critical role in the development and progression of drug resistance malignancies. We have previously showed the association of TG2 upregulation with progression and metastasis
Ramon L Serrano et al.
PloS one, 14(4), e0212235-e0212235 (2019-04-04)
Neointimal hyperplasia, stimulated by injury and certain vascular diseases, promotes artery obstruction and tissue ischemia. In vascular smooth muscle cell (VSMCs), multiple modulators of protein handling machinery regulate intimal hyperplasia. These include elements of the VSMC unfolded protein response to
Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica