Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU100381

Sigma-Aldrich

MISSION® esiRNA

targeting human RLN2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCCATCCTTCATCAACAAAGATACAGAAACCATAAATATGATGTCAGAATTTGTTGCTAATTTGCCACAGGAGCTGAAGTTAACCCTGTCTGAGATGCAGCCAGCATTACCACAGCTACAACAACATGTACCTGTATTAAAAGATTCCAGTCTTCTCTTTGAAGAATTTAAGAAACTTATTCGCAATAGACAAAGTGAAGCCGCAGACAGCAGTCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAGAGACAACTCTACAGTGCATTGGCTAATAAATGTTGCCATGTTGGTTG

Ensembl | Número de adesão de ser humano

ENSG00000107014

nº de adesão NCBI

NM_134441

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RLN2(6013) , RLN2(6019)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jinfeng Ma et al.
BioMed research international, 2015, 147468-147468 (2015-08-01)
The aim of the study was to determine the effect of H2 relaxin (RLN2) on invasion, migration, and chemosensitivity to cisplatin in human osteosarcoma U2-OS and MG-63 cells and then to investigate the effect of RLN2 on the AKT/NF-κB signaling

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica