Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Ensembl | Número de adesão de ser humano

ENSG00000160200

nº de adesão NCBI

NM_000071

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CBS(102724560) , CBS(875)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Huina Jia et al.
Oncology reports, 37(5), 3001-3009 (2017-04-26)
Hydrogen sulfide (H2S), the third gasotransmitter, plays important roles in cancer biological processes. As endogenous H2S exerts pro-cancer functions, inhibition of its production in cancer cells may provide a new cancer treatment strategy and be achieved via regulation of the function
Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Nozomu Takahashi et al.
Nucleic acids research, 45(1), 435-445 (2016-08-29)
The 2-methylthio (ms
Xiangning Yuan et al.
Kidney & blood pressure research, 42(3), 428-443 (2017-07-28)
Renal tubulointerstitial fibrosis (TIF) is the common pathway of progressive chronic kidney disease. Inflammation has been widely accepted as the major driving force of TIF. Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway. CBS is
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica