Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU097671

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGATTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACC

Ensembl | Número de adesão de ser humano

ENSG00000137752

nº de adesão NCBI

NM_033295

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CASP1(834) , CASP1(834)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Weigang Zhang et al.
The Journal of pathology, 241(3), 392-404 (2016-11-20)
Psoriasis is an autoimmune skin disease, in which keratinocytes play a crucial pathogenic role. High-mobility group protein B1 (HMGB1) is an inflammatory factor that can be released from keratinocyte nuclei in psoriatic lesions. We aimed to investigate the proinflammatory effect
Vahid Mirshafiee et al.
ACS nano, 12(4), 3836-3852 (2018-03-16)
The liver and the mononuclear phagocyte system are a frequent target for engineered nanomaterials, either as a result of particle uptake and spread from primary exposure sites or systemic administration of therapeutic and imaging nanoparticles. In this study, we performed
Xiang Wang et al.
Small (Weinheim an der Bergstrasse, Germany), 16(21), e2000528-e2000528 (2020-04-28)
The mononuclear phagocyte system in the liver is a frequent target for nanoparticles (NPs). A toxicological profiling of metal-based NPs is performed in Kupffer cell (KC) and hepatocyte cell lines. Sixteen NPs are provided by the Nanomaterial Health Implications Research
Tianhao Huang et al.
Cell death & disease, 8(4), e2726-e2726 (2017-04-07)
Non-small-cell lung cancer (NSCLC) is one of the leading causes of cancer-related death worldwide. Although epigenetic deregulation is known to be important for tumor progression, the molecular mechanisms in NSCLC remain unclear. Here, we found that G9A (known as EHMT2)
Jason-Alexander Hörauf et al.
International journal of molecular sciences, 21(9) (2020-05-06)
This paper discusses how the assembly of pro-caspase-1 and apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC) in macromolecular protein complexes, inflammasomes, activates caspase-1. The present study investigates the molecular mechanisms of inflammasome activation in HepG2 cells and examines how
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica