Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU095101

Sigma-Aldrich

MISSION® esiRNA

targeting human NRG1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACCATCACCCTCAGCAGTTCAGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGGATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTTAAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAACAGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAAGATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Youya Wang et al.
Journal of thoracic disease, 10(6), 3166-3179 (2018-08-03)
Neuregulin1 (NRG1) is critical signaling protein that mediates the activation of downstream signaling pathways associated with malignancies. Multiple gene fusions related to NRG1 have been found in lung cancer. However, the underlying role NRG1 in lung cancer is yet unclear.
K Yonesaka et al.
Oncogene, 35(7), 878-886 (2015-05-12)
Human epidermal growth factor receptor (HER) 3 is aberrantly overexpressed and correlates with poor prognosis in non-small cell lung cancer (NSCLC). Patritumab is a monoclonal antibody against HER3 that has shown promising results in early-phase clinical trials, but an optimal
Alessandra Bolino et al.
EMBO molecular medicine, 8(12), 1438-1454 (2016-11-02)
Charcot-Marie-Tooth (CMT) neuropathies are highly heterogeneous disorders caused by mutations in more than 70 genes, with no available treatment. Thus, it is difficult to envisage a single suitable treatment for all pathogenetic mechanisms. Axonal Neuregulin 1 (Nrg1) type III drives

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica