Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU093851

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GATGACTTGTGGGTGCTCCTGGCTCAACCCAACCAACAGGACTGACTGACTGGCAGGACAAGGTCTGGCATGGCACAGCACCACTGCCAGGCCTCCCCAGGCACACCACTCTGCCCAGGGAATGGGGGCTTTGGGTCATCTCCCACTGCCTGGGGGAGTCAGATGGGGTGCAGGAATCTGGCTCTTCAGCCATCTCAGGTTTAGGGGGTTTGTAACAGACATTATTCTGTTTTCACTGCGTATCCTTGGTAAGCCCTGTGGACTGGTTCCTGCTGTGTGATGCTGAGGGTTTTAAGGTGGGGAGAGATAAGGGCTCTCTCGGGCCATGCTACCCGGTATGACTGGGTAATGAGGACAGACTGTGGACACCCCATCTACCTGAGTCTGATTCTTTAGCAGCAGAGACTGAGGGGTGCAGAGTGT

Ensembl | Número de adesão de ser humano

ENSG00000064547

nº de adesão NCBI

NM_004720

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LPAR2(9170) , LPAR2(9170)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zi Wang et al.
Journal of molecular medicine (Berlin, Germany), 98(12), 1781-1794 (2020-11-01)
Autotaxin (ATX) is a secreted enzyme that hydrolyzes lysophosphatidylcholine (LPC) to lysophosphatidic acid (LPA) and choline. ATX has been implicated in multiple chronic inflammatory diseases, but little is known about its role in the development of inflammatory bowel disease (IBD).
Ying Zhang et al.
OncoTargets and therapy, 13, 4145-4155 (2020-06-12)
The dysregulation of the human papillomavirus 18 E6 and E7 oncogenes plays a critical role in the angiogenesis of cervical cancer (CC), including the proliferation, migration, and tube formation of vascular endothelial cells. Interfering E6/E7 increases the number of CC
Simon McArthur et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 1139-1151 (2015-06-24)
Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica