Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093811

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAGCCATTCCTCATGTCAAATATTTGGATTTGACAAACAATAGACTAGACTTTGATAATGCTAGTGCTCTTACTGAATTGTCCGACTTGGAAGTTCTAGATCTCAGCTATAATTCACACTATTTCAGAATAGCAGGCGTAACACATCATCTAGAATTTATTCAAAATTTCACAAATCTAAAAGTTTTAAACTTGAGCCACAACAACATTTATACTTTAACAGATAAGTATAACCTGGAAAGCAAGTCCCTGGTAGAATTAGTTTTCAGTGGCAATCGCCTTGACATTTTGTGGAATGATGATGACAACAGGTATATCTCCATTTTCAAAGGTCTCAAGAATCTGACACGTCTGGATTTATCCCTTAATAGGCTGAAGCACATCCCAAATGAAGCATTCCTTAATTTGCCAGCGAGTCTCACT

Ensembl | Número de adesão de ser humano

ENSG00000101916

nº de adesão NCBI

NM_138636

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TLR8(51311) , TLR8(51311)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
UFS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

G Comito et al.
Oncogene, 38(19), 3681-3695 (2019-01-22)
Leukocyte infiltration plays an active role in controlling tumor development. In the early stages of carcinogenesis, T cells counteract tumor growth. However, in advanced stages, cancer cells and infiltrating stromal components interfere with the immune control and instruct immune cells
Huanle Luo et al.
Antiviral research, 151, 55-62 (2018-01-15)
Zika virus (ZIKV) is a mosquito-borne flavivirus associated with severe neonatal birth defects, but the causative mechanism is incompletely understood. ZIKV shares sequence homology and early clinical manifestations with yellow fever virus (YFV) and dengue virus (DENV) and are all
Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica