Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093651

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTGATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGACTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATTTGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTGATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACTATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCCGTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAAAGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yue Zhang et al.
Journal of molecular cell biology, 11(9), 761-769 (2018-12-12)
X chromosome inactivation and genomic imprinting are two classic epigenetic regulatory processes that cause mono-allelic gene expression. In female mammals, mono-allelic expression of the long non-coding RNA gene X-inactive specific transcript (XIST) is essential for initiation of X chromosome inactivation
Wendi Shuai et al.
Cancer letters, 422, 56-69 (2018-02-20)
Suppressor of variegation 3-9 homolog 2 (SUV39H2) is a member of the SUV39H subfamily of lysine methyltransferases. Its role in colorectal cancer (CRC) proliferation and metastasis has remained unexplored. Here, we determined that SUV39H2 was upregulated in CRC tissues compared
Emily B Askew et al.
Molecular and cellular endocrinology, 443, 42-51 (2017-01-04)
Androgen receptor (AR) transcriptional activity depends on interactions between the AR NH
Oriane Mauger et al.
Nucleic acids research, 43(3), 1869-1882 (2015-01-22)
Alternative splicing is the main source of proteome diversity. Here, we have investigated how alternative splicing affects the function of two human histone methyltransferases (HMTase): G9A and SUV39H2. We show that exon 10 in G9A and exon 3 in SUV39H2

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica