Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

Ensembl | Número de adesão de ser humano

ENSG00000142082

nº de adesão NCBI

NM_012239

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SIRT3(23410) , SIRT3(23410)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Aplicação

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Ações bioquímicas/fisiológicas

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BDV
HYU
ZXU
QWU
CWU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges.
Cheng A
Cell Metabolism, 23, 128-142 (2016)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the
Chao Song et al.
Free radical biology & medicine, 112, 616-630 (2017-09-16)
Mitochondrial reactive oxygen species (ROS) production has been implicated in the pathogenesis of fluoride toxicity in liver. Melatonin, an indolamine synthesized in the pineal gland, was previously shown to protect against sodium fluoride (NaF)-induced hepatotoxicity. This study investigated the protective
Cai Shumin et al.
Cell death discovery, 4, 52-52 (2018-05-16)
Genipin (GP) is commonly used to treat cardiovascular diseases; however, the protective action of GP against vascular hyperpermeability (VH) has not been reported. We previously reported that intrinsic apoptotic signaling (IAS) is involved in VH following hemorrhagic shock (HS). GP
Pro-Proliferative Function of Mitochondrial Sirtuin Deacetylase SIRT3 in Human Melanoma.
George J
The Journal of Investigative Dermatology, 136, 809-809 (2016)
Exibir todos os documentos relacionados

Global Trade Item Number

SKUGTIN
EHU093591-20UG4061831356236
EHU093591-50UG4061828363216

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica