Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU093581

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNND1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGGCTGAAGTTGAACATGGGAGCTTATTGCTAATTTAGAGATAGGAAACTGAAGCATAAAGAATTAATGACTTACTTTAATTACTGGAATTCTTCTGCAACATTTGACAAAACTAACCTTGAATAAGGCCCACTGTAATACGTAGCTCTCTTAAATATAACACTTAGGACTAGAAGATTAGAAACTACCAATCCCAACTACGTAATAGGAAAATGTAGGATCAAAAGGCCCATGTATATAAGTACTGACCACTGGGCCATAATGTTGCTTCTCAGGCTATATGCAGTCCTTTAGTCAGAAGTCAATAGGCCTATTTATTAATATTTTACAGACCATATTACCTGGATTACCAGGGACTATCTTTGCTGC

Ensembl | Número de adesão de ser humano

ENSG00000198561

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CTNND1(1500) , CTNND1(1500)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ningjia Cao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 483-490 (2018-07-11)
MicroRNAs (miRNAs) are solid factors involved in the initiation and progression of hepatocellular carcinoma (HCC). Recently, miR-298 is recognized as a cancer-associated miRNA in breast, gastric and ovarian cancer. However, the functional role of miR-298 and its underlying mechanism are
Alisha M Mendonsa et al.
PloS one, 15(6), e0235337-e0235337 (2020-06-27)
p120-catenin is considered to be a tumor suppressor because it stabilizes E-cadherin levels at the cell surface. p120-catenin phosphorylation is increased in several types of cancer, but the role of phosphorylation in cancer is unknown. The phosphorylation state of p120-catenin
Rong Wang et al.
Molecular carcinogenesis, 56(7), 1733-1742 (2017-02-22)
The heterocyclic amine 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) targets multiple organs for tumorigenesis in the rat, including the colon and the skin. PhIP-induced skin tumors were subjected to mutation screening, which identified genetic changes in Hras (7/40, 17.5%) and Tp53 (2/40, 5%), but
Josué Curto et al.
Molecular oncology, 12(5), 611-629 (2018-02-22)
Canonical and noncanonical Wnt pathways share some common elements but differ in the responses they evoke. Similar to Wnt ligands acting through the canonical pathway, Wnts that activate the noncanonical signaling, such as Wnt5a, promote Disheveled (Dvl) phosphorylation and its
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica