Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU093121

Sigma-Aldrich

MISSION® esiRNA

targeting human CTTN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGGGTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTGAAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGCATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTACCACAATGAGCAATGAGGTCGGGTTTTA

Ensembl | Número de adesão de ser humano

ENSG00000085733

nº de adesão NCBI

NM_138565

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CTTN(2017) , CTTN(2017)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rachel J Watkins et al.
The Journal of clinical endocrinology and metabolism, 101(12), 4551-4563 (2016-09-08)
Metastatic disease is responsible for the majority of endocrine cancer deaths. New therapeutic targets are urgently needed to improve patient survival rates. The proto-oncogene PTTG1-binding factor (PBF/PTTG1IP) is overexpressed in multiple endocrine cancers and circumstantially associated with tumor aggressiveness. This
Xiaojian Zhang et al.
Oncotarget, 8(1), 1541-1554 (2016-12-03)
Cortactin (CTTN) is overexpressed in various tumors, including head and neck squamous cell carcinoma and colorectal cancer (CRC), and can serve as a biomarker of cancer metastasis. We observed that CTTN promotes cancer cell proliferation in vitro and increases CRC
Dominik Horn et al.
Head & neck, 40(12), 2685-2694 (2018-11-21)
Cortactin (CTTN) is located on chromosome 11q13 and is associated with invasiveness in various cancer entities. CTTN protein expression could be a prognosticator of oral squamous cell carcinoma (OSCC) in terms of recurrence and survival. CTTN-dependent invasion was performed using
Yang Cheng et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 34(10), 853-858 (2018-04-17)
Vascular endothelial growth factor C (VEGF-C) accelerates cervical cancer metastasis, while the detailed mechanism remains largely unknown. Recent evidence indicates that microRNA play a crucial role in controlling cancer cell invasiveness. In the present study, we investigated the role of
Steven M Markwell et al.
Molecular cancer research : MCR, 17(4), 987-1001 (2019-01-06)
Malregulation of the actin cytoskeleton enhances tumor cell motility and invasion. The actin-binding protein cortactin facilitates branched actin network formation through activation of the actin-related protein (Arp) 2/3 complex. Increased cortactin expression due to gene amplification is observed in head
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica