Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093011

Sigma-Aldrich

MISSION® esiRNA

targeting human TPX2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCACCAAAGAAGATGAGGAAGAGGACGAACCGGTAGTGATAAAAGCTCAACCTGTGCCACATTATGGGGTGCCTTTTAAGCCCCAAATCCCAGAGGCAAGAACTGTGGAAATATGCCCTTTCTCGTTTGATTCTCGAGACAAAGAACGTCAGTTACAGAAGGAGAAGAAAATAAAAGAACTGCAGAAAGGGGAGGTGCCCAAGTTCAAGGCACTTCCCTTGCCTCATTTTGACACCATTAACCTGCCAGAGAAGAAGGTAAAGAATGTGACCCAGATTGAACCTTTCTGCTTGGAGACTGACAGAAGAGGTGCTCTGAAGGCACAGACTTGGAAGCACCAGCTGGAAGAAGAACTGAGACAGCAGAAAGAAGCAGCTTGTTTCAAGGCTCGTCCAAACACCGTCATCTCTCAGGAGCCCTTTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast
Helen Chen et al.
Cell cycle (Georgetown, Tex.), 13(14), 2248-2261 (2014-05-31)
Construction of a mitotic spindle requires biochemical pathways to assemble spindle microtubules and structural proteins to organize these microtubules into a bipolar array. Through a complex with dynein, the receptor for hyaluronan-mediated motility (RHAMM) cross-links mitotic microtubules to provide structural
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica