Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD151

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAGGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Laura A Fast et al.
International journal of molecular sciences, 19(10) (2018-10-04)
Tetraspanins are suggested to regulate the composition of cell membrane components and control intracellular transport, which leaves them vulnerable to utilization by pathogens such as human papillomaviruses (HPV) and cytomegaloviruses (HCMV) to facilitate host cell entry and subsequent infection. In
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 139(1), 82-92 (2016-05-29)
Airway smooth muscle (ASM) contraction underpins airway constriction; however, underlying mechanisms for airway hyperresponsiveness (AHR) remain incompletely defined. CD151, a 4-transmembrane glycoprotein that associates with laminin-binding integrins, is highly expressed in the human lung. The role of CD151 in ASM
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 141(5), 1799-1817 (2017-12-24)
Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Jérôme Finke et al.
Scientific reports, 10(1), 5356-5356 (2020-03-27)
During cell invasion, human papillomaviruses use large CD151 patches on the cell surface. Here, we studied whether these patches are defined architectures with features for virus binding and/or internalization. Super-resolution microscopy reveals that the patches are assemblies of closely associated

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica