Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU092681

Sigma-Aldrich

MISSION® esiRNA

targeting human ADK

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGTACAAGGGTATGGTAATGCTTGTAGAATCTTTATTATCTCAACAATCTAAAAAATGATGTTTATTTCCATAGTTTGATAGTGCCACTTAAATGCCAATTAAACAAGAATATAACATTTCAATAGAAATTTTTATTTCATTTTCAATTACTTTGTAAATTCGTGTGTATTTAGTACACTGATTTGTTTTTTTACATTTCTGCTTTGAATGCAGATGCAATTTAATATAATAGATTTTTTAATGAATTAATCTTAACATAGTAATCTTTAGCTTTTTATACAAATATATTTAATTTAGGAGTATATGTGTGTCTATACACACACATACATAAATATACCACATATACACCTGATAGTCAAATAAGGTACAGAAATTTTATCTTGTCAATTATGCCAAATAATCTCTTTAATGTGCACTCAAACA

Ensembl | Número de adesão de ser humano

ENSG00000156110

nº de adesão NCBI

NM_001123

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADK(132) , ADK(132)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei Jin et al.
Journal of molecular histology, 47(3), 259-271 (2016-03-18)
Adenosine kinase (ADK) plays a pivotal role in regulating brain function by regulating adenosine level, and ADK inhibition protects against neuronal damage in cerebral ischemia and epilepsy; however, the effects of ADK in traumatic brain injury (TBI) have not been
Iwona Pelikant-Malecka et al.
The international journal of biochemistry & cell biology, 88, 31-43 (2017-03-23)
4-pirydone-3-carboxamide-1β-d-ribonucleoside (4PYR) is an endogenous nucleoside that could be converted to triphosphates, diphosphates, monophosphates and an analogue of NAD - 4PYRAD. Elevated level of these compounds have been reported in chronic renal failure, cancer and active HIV infection. However, little
Alexander J Valvezan et al.
JCI insight, 5(7) (2020-04-10)
Recent studies in distinct preclinical tumor models have established the nucleotide synthesis enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) as a viable target for antitumor therapy. IMPDH inhibitors have been used clinically for decades as safe and effective immunosuppressants. However, the potential to
Tal Israeli et al.
Journal of cell science, 131(15) (2018-07-14)
AMPK-mTORC1 signaling senses nutrient availability, thereby regulating autophagy. Surprisingly, we found that, in β-cells, the AMPK activator 5-amino-4-imidazolecarboxamide ribofuranoside (AICAR) inhibited, rather than stimulated, autophagy. AICAR is an intermediate in the generation of inosine monophosphate, with subsequent conversion to other

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica