Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092661

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCTCTGCAAACTTCCATTCTTTAGATGACATCTACTATTTTGGGGGCCAGAATGCCCACAATCAAATTGCCATTTATGCTCACCAACCCCGAACTGCAGATGAAATTCCCATGGAACCTGGAGATATCATTGGTGTGGCTGGAAATCATTGGGATGGCTATTCTAAAGGTGTCAACAGGAAATTGGGAAGGACGGGCCTATATCCCTCCTACAAAGTTCGAGAGAAGATAGAAACGGTCAAGTACCCCACATATCCTGAGGCTGAGAAATAAAGCTCAGATGGAAGAGATAAACGACCAAACTCAGTTCGACCAAACTCAGTTCAAACCATTTCAGCCAAACTGTAGATGAAGAGGGCTCTGATCTAACAAAATAAGGTTATATGAGTAGATACTCTCAGCACCAAGAGCAGCTGGGAACTGAC

Ensembl | Número de adesão de ser humano

ENSG00000033170

nº de adesão NCBI

NM_178154

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FUT8(2530) , FUT8(2530)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ming Yu et al.
Placenta, 75, 45-53 (2019-02-05)
Trophoblast proliferation and invasion are essential for embryo implantation and placentation. Protein glycosylation is one of the most common and vital post-translational modifications, regulates protein physical and biochemical properties. FUT8 is the only known fucosyltransferase responsible for catalyzing α1,6-fucosylation in
Shu Li et al.
Viruses, 11(4) (2019-04-27)
Hepatitis C virus (HCV) is a major cause of human chronic liver disease and hepatocellular carcinoma. Our recent studies showed that α1,6-fucosyltransferase (FUT8), a key glycosyltransferase, was the most up-regulated glycosyltransferase after the HCV infection of human hepatocellular carcinoma Huh7.5.1
Kazuhiro Tada et al.
Surgery today, 50(7), 767-777 (2020-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. It is an aggressive malignancy associated with poor prognosis because of recurrence, metastasis, and treatment resistance. Aberrant glycosylation of cancer cells triggers their migration and invasion and is
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica