Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092111

Sigma-Aldrich

MISSION® esiRNA

targeting human FUS

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACGTCATGACTCCGAACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGTTACAATTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCTCTTTTGATGACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCCTATCAAGGTCTCATTTGCTACTCGCCGGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGAGGACCCATGGGCCGTGGAGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTGGAGGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lisa Gasperini et al.
Molecular biology of the cell, mbcE18020108-mbcE18020108 (2018-10-26)
RALY is a member of the heterogeneous nuclear ribonucleoprotein family whose transcriptome and interactome have been recently characterized. RALY binds poly-U rich elements within several RNAs and regulates the expression as well as the stability of specific transcripts. Here we
Haibo Wang et al.
Nature communications, 9(1), 3683-3683 (2018-09-13)
Genome damage and defective repair are etiologically linked to neurodegeneration. However, the specific mechanisms involved remain enigmatic. Here, we identify defects in DNA nick ligation and oxidative damage repair in a subset of amyotrophic lateral sclerosis (ALS) patients. These defects
Michail S Kukharsky et al.
Molecular neurodegeneration, 10, 20-20 (2015-04-19)
Mutations in calcium-responsive transactivator (CREST) encoding gene have been recently linked to ALS. Similar to several proteins implicated in ALS, CREST contains a prion-like domain and was reported to be a component of paraspeckles. We demonstrate that CREST is prone
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica