Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU092071

Sigma-Aldrich

MISSION® esiRNA

targeting human FTO

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGAAGATTGGCCTCTTTCCTTTCTCTAAGACAAACCTAAGTAAAAGCCTGAGCTTTGAGTCCTATGCTCAGCACACGGGAAGGAGATGTTAATAATTAAAATAAAGTTGATATCCTGTCTTTAGGGAGTTCCCTTGATCTCTTGAAAGAGACACAGCCCCATTTACATTATTTCGTGGATTTCACCAGCATAGTATAGTTTTTTTCTGTAAGTCCCTCATTCTTATGTAATAACAGGTGGAACTGAGGTTTGAAGAACCTCAGTGGCCCATCCTGATGACATTGGAGACTCAAAGAGACAAGAGAGAGTAGGGTTTAAAACCTGAGCTTTAAGACTCCCACTAGCTTCGTGTCCTTTGGCATGTTAACGTGCCTCAGTTTCCTCATCTGTATAATGGGGATATATGAAAGGCACCAGTCCTAAGG

Ensembl | Número de adesão de ser humano

ENSG00000140718

nº de adesão NCBI

NM_001080432

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FTO(79068) , FTO(79068)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dong Xu et al.
Oncology reports, 38(4), 2285-2292 (2017-08-30)
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Ziqi Ye et al.
Oncology letters, 20(2), 1409-1417 (2020-07-30)
Liver cancer is the fourth leading cause of cancer-associated mortality worldwide. Statistics indicate that the incidence of liver cancer has been increasing and that its prognosis remains poor. Fat mass and obesity-associated protein (FTO) is a demethylase that is involved
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Bo-Jhih Guan et al.
Molecular cell, 68(5), 885-900 (2017-12-09)
The integrated stress response (ISR) is a homeostatic mechanism induced by endoplasmic reticulum (ER) stress. In acute/transient ER stress, decreased global protein synthesis and increased uORF mRNA translation are followed by normalization of protein synthesis. Here, we report a dramatically

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica