Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU091571

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

Ensembl | Número de adesão de ser humano

ENSG00000182985

nº de adesão NCBI

NM_014333

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CADM1(23705) , CADM1(23705)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type
Peter J Chockley et al.
The Journal of clinical investigation, 128(4), 1384-1396 (2018-01-13)
During epithelial-mesenchymal transition (EMT) epithelial cancer cells transdifferentiate into highly motile, invasive, mesenchymal-like cells, giving rise to disseminating tumor cells. Few of these disseminated cells successfully metastasize. Immune cells and inflammation in the tumor microenvironment were shown to drive EMT

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica