Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU091471

Sigma-Aldrich

MISSION® esiRNA

targeting human CPEB4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCATTCCTGCTGTTTCAAGATGAAAGCTCTGTGCAGGCTCTCATTGATGCATGCATTGAAGAAGATGGAAAACTCTACCTTTGTGTATCAAGTCCCACTATCAAGGATAAGCCAGTCCAGATTCGGCCTTGGAATCTCAGTGACAGTGACTTTGTGATGGATGGTTCACAGCCACTTGACCCACGAAAAACTATATTTGTTGGTGGTGTTCCTCGACCATTACGAGCTGTGGAGCTTGCGATGATAATGGATCGGCTATATGGAGGTGTGTGCTACGCTGGGATTGATACCGACCCTGAGCTAAAATACCCAAAAGGAGCTGGGAGAGTTGCGTTCTCTAATCAACAGAGTTACATAGCTGCTATCAGTGCCCGCTTTGTTCAGCTGCAGCATGGAGAGATAGATAAACGGGTGGAAGTTAAGCC

Ensembl | Número de adesão de ser humano

ENSG00000113742

nº de adesão NCBI

NM_030627

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CPEB4(80315) , CPEB4(80315)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Eva Pérez-Guijarro et al.
Nature communications, 7, 13418-13418 (2016-11-20)
Nuclear 3'-end-polyadenylation is essential for the transport, stability and translation of virtually all eukaryotic mRNAs. Poly(A) tail extension can also occur in the cytoplasm, but the transcripts involved are incompletely understood, particularly in cancer. Here we identify a lineage-specific requirement
Valeria Giangarrà et al.
PloS one, 10(9), e0138794-e0138794 (2015-09-24)
CPEB (Cytoplasmic Polyadenylation Element Binding) proteins are a family of four RNA-binding proteins that regulate the translation of maternal mRNAs controlling meiotic cell cycle progression. But CPEBs are not limited to the transcriptionally silent germline; they are also expressed, in
Weihua Huang et al.
Diagnostic pathology, 10, 127-127 (2015-07-26)
The microRNAs present a class of non-coding RNAs which are usually implicated in tumor biology. Recent report has unraveled that a novel member of microRNA family called miR-1246. However, the functional role and molecular mechanisms of miR-1246 in non-small cell

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica