Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU090991

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATA

Ensembl | Número de adesão de ser humano

ENSG00000007372

nº de adesão NCBI

NM_001604

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PAX6(5080) , PAX6(5080)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hassan Akrami et al.
Journal of ophthalmic & vision research, 4(3), 134-141 (2009-07-01)
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in
Zhe Qian et al.
Respiratory research, 19(1), 262-262 (2018-12-31)
This study investigated the function of SMAD3 (SMAD family member 3) in regulating PAX6 (paired box 6) in non-small cell lung cancer. First, qRT-PCR was employed to detect SMAD3 expression in cancer tissues along with normal tissues and four cell lines
Akira Ooki et al.
Oncogene, 37(45), 5967-5981 (2018-07-08)
It remains unclear whether PAX6 acts as a crucial transcription factor for lung cancer stem cell (CSC) traits. We demonstrate that PAX6 acts as an oncogene responsible for induction of cancer stemness properties in lung adenocarcinoma (LUAD). Mechanistically, PAX6 promotes
Siri Forsdahl et al.
PloS one, 9(7), e102559-e102559 (2014-07-17)
Pax6 is a transcription factor important for early embryo development. It is expressed in several cancer cell lines and tumors. In glioblastoma, PAX6 has been shown to function as a tumor suppressor. Dickkopf 3 (Dkk3) is well established as a

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica