Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU090371

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGCACGTACACAGCCCTAATCATAGCTACAGACAATGGTTCTCCAGTTGCTACTGGAACAGGGACACTTCTGCTGATCCTGTCTGATGTGAATGACAACGCCCCCATACCAGAACCTCGAACTATATTCTTCTGTGAGAGGAATCCAAAGCCTCAGGTCATAAACATCATTGATGCAGACCTTCCTCCCAATACATCTCCCTTCACAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAACCCAAGAATCTATCATTTTGAAGCCAAAGATGGCCTTAGAGGTGGGTGACTACAAAATCAATCTCAAGCTCATGGATAACCAGAATAAAGACCAAGTGACCACCTTAGAGGTCAGCGTGTGTGACTGTGAAGGGGCCGCTGGCGTCTGTAGGAAGGCACAGCCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Branka Petrić Miše et al.
Pathology oncology research : POR, 21(2), 347-356 (2014-08-12)
To analyze correlation between immunoexpression of E-cadherin and efficacy of first line platinum-based chemotherapy in patients with advanced-stage high-grade serous ovarian carcinoma. The expression of E-cadherin was analyzed immunohistochemically in formalin-fixed, paraffin-embedded samples from 98 patients with advanced-stage high-grade serous
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Shuai Xiao et al.
Digestive diseases and sciences, 60(4), 910-918 (2014-11-05)
Epithelial-mesenchymal transition (EMT) plays an important role in hepatocellular carcinoma (HCC) dissemination. Bromodomain PHD-finger transcription factor (BPTF) could regulate embrogenesis and stem cell differentiation, and it may be involved in tumor progression and EMT. In this study, we aimed to
Alex Chernyavsky et al.
International immunopharmacology, 29(1), 76-80 (2015-05-24)
The mechanism of detachment and death of keratinocytes in pemphigus vulgaris (PV) involves pro-apoptotic action of constellations of autoantibodies determining disease severity and response to treatment. The presence of antibodies to nicotinic acetylcholine receptors (nAChRs) and the therapeutic efficacy of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica