Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Ensembl | Número de adesão de ser humano

ENSG00000048052

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC9(9734) , HDAC9(9734)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BZS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is
Yue Yang et al.
The Journal of nutritional biochemistry, 40, 172-177 (2016-12-05)
Activation of hepatic stellate cells (HSCs) is critical for liver fibrosis development. Previously, we showed that astaxanthin (ASTX), a xanthophyll carotenoid, has antifibrogenic effects in LX-2 cells, a human HSC cell line. We sought to determine the effect of ASTX
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Changliang Shan et al.
Cell death & disease, 10(7), 525-525 (2019-07-10)
4-hydroxyphenylpyruvate dioxygenase (HPD) is an important modifier of tyrosine metabolism. However, the precise contribution of HPD to cancer metabolism and tumorigenesis remains unclear. In this study, we found that HPD was highly expressed in lung cancer and its higher expression
Dong-Qin Chen et al.
Therapeutic advances in medical oncology, 10, 1758835918783132-1758835918783132 (2018-07-24)
Treatment of metastatic castration-resistant prostate cancer (mCRPC) with docetaxel often fails due to the emergence of chemoresistance. Thus, restoring chemosensitivity to docetaxel-based therapies remains a challenge in mCRPC treatment. microRNA (miR)-451 expression was measured in docetaxel-treated prostate cancer cells and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica