Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU089561

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM12

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACCTCTGGATCCCAGTGAAGAGCTTCGACTCCAAGAATCATCCAGAAGTGCTGAATATTCGACTACAACGGGAAAGCAAAGAACTGATCATAAATCTGGAAAGAAATGAAGGTCTCATTGCCAGCAGTTTCACGGAAACCCACTATCTGCAAGACGGTACTGATGTCTCCCTCGCTCGAAATTACACGGTAATTCTGGGTCACTGTTACTACCATGGACATGTACGGGGATATTCTGATTCAGCAGTCAGTCTCAGCACGTGTTCTGGTCTCAGGGGACTTATTGTGTTTGAAAATGAAAGCTATGTCTTAGAACCAATGAAAAGTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTCCGGGGATCATGTGGATCACATCACAACACACCAAACCTCGCTGCAAAGAATGT

Ensembl | Número de adesão de ser humano

ENSG00000148848

nº de adesão NCBI

NM_021641

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADAM12(8038) , ADAM12(8038)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ACKS
GVR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lingdan Chen et al.
Experimental biology and medicine (Maywood, N.J.), 242(14), 1432-1443 (2017-06-24)
Individuals with diabetes mellitus suffer from impaired angiogenesis and this contributes to poorer peripheral arterial disease outcomes. In experimental peripheral arterial disease, angiogenesis and perfusion recovery are impaired in mice with diabetes. We recently showed that a disintegrin and metalloproteinase
Junwen Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 1066-1077 (2017-11-16)
Pituitary adenomas are the second most common primary brain tumor with invasive properties. We have previously identified that ADAM12 (a disintegrin and metalloprotease 12) overexpression is associated with the tumor invasion of pituitary adenomas, however, the underlying mechanism remains unknown.
Sara Duhachek-Muggy et al.
Molecular cancer, 16(1), 32-32 (2017-02-06)
ADAM12 is upregulated in human breast cancers and is a predictor of chemoresistance in estrogen receptor-negative tumors. ADAM12 is induced during epithelial-to-mesenchymal transition, a feature associated with claudin-low breast tumors, which are enriched in cancer stem cell (CSC) markers. It
Yuto Nakamura et al.
American journal of physiology. Heart and circulatory physiology, 318(2), H238-H251 (2019-11-28)
A disintegrin and metalloproteinase (ADAM)12 is considered to promote cardiac dysfunction based on the finding that a small-molecule ADAM12 inhibitor, KB-R7785, ameliorated cardiac function in a transverse aortic constriction (TAC) model by inhibiting the proteolytic activation of heparin-binding-EGF signaling. However
Roopali Roy et al.
Molecular cancer research : MCR, 15(11), 1608-1622 (2017-08-03)
ADAM12, (
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica