Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU089381

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD9

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGAGGAGCTGGATGGATGACTACGATTACGTCCACCTACAGGGTAAGGAGGAGTTTGAGAGGCAACAGAAAGAGCTATTGGAAAAAGAGAATATCATGAAACAGAACAAGATGCAGCTGGAACATCATCAGCTGAGCCAGTTCCAGCTGTTGGAACAAGAGATTACAAAGCCCGTGGAGAATGACATCTCGAAGTGGAAGCCCTCTCAGAGCCTACCCACCACAAACAGTGGCGTGAGTGCTCAGGATCGGCAGTTGCTGTGCTTCTACTATGACCAATGTGAGACCCATTTCATTTCCCTTCTCAACGCCATTGACGCACTCTTCAGTTGTGTCAGCTCAGCCCAGCCCCCGCGAATCTTCGTGGCACACAGCAAGTTTGTCATCCTCAGTGCACACA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiling Tang
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 782-786 (2018-07-14)
To investigate the effects of human enhancer of filamentation 1 (HEF1) gene on the proliferation, invasion and metastasis of bladder cancer cells. Three human bladder cancer cell lines (T24, EJ and BIU-87) were selected to extract total RNA at logarithmic
Nosheen Akhtar et al.
Molecular carcinogenesis, 57(5), 653-663 (2018-02-14)
Epithelial-to-mesenchymal transition (EMT) plays a crucial role in prostate cancer (PCa) metastasis. This has led to a surge in the efforts for identification of safer and more effective compounds which can modulate EMT and consequently inhibiting migration and invasion of
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Peng Lu et al.
Oncology reports, 33(5), 2375-2383 (2015-03-31)
Neural precursor cell expressed, developmentally downregulated 9 (NEDD9) plays an integral role in natural and pathological cell biology. Overexpression of NEDD9 protein has been correlated with poor prognosis in various types of cancer. However, few available data address the precise

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica