Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU088741

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCA

Ensembl | Número de adesão de ser humano

ENSG00000147099

nº de adesão NCBI

NM_018486

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC8(55869) , HDAC8(55869)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
HPS
JAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Michael F Emmons et al.
Cancer research, 79(11), 2947-2961 (2019-04-17)
Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype in response to multiple stimuli. Here, we show that exposure of melanomas to multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV irradiation leads to an increase in
G R Vanaja et al.
Cell communication and signaling : CCS, 16(1), 20-20 (2018-05-03)
Histone deacetylases (HDACs) are involved in epigenetic gene regulation via deacetylation of acetylated lysine residues of both histone and non-histone proteins. Among the 18 HDACs identified in humans, HDAC8, a class I HDAC, is best understood structurally and enzymatically. However
Zhouxiang Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1645-1653 (2016-11-17)
Despite the use of novel anti-myeloma agents,nearly all patients will eventually relapse or become refractory to drug treatment. New and more effective drugs for multiple myeloma (MM) are urgently needed. The JAK-STAT signaling pathway is important in the proliferation of
Ganggang Kong et al.
Journal of neurotrauma, 34(18), 2645-2655 (2017-07-08)
The ketone metabolite β-hydroxybutyrate (βOHB), is reported to be neuroprotective after spinal cord injury (SCI) in rats, but the underlying mechanism remains unknown. The present study aims to investigate effects of βOHB on suppression of oxidative stress and inhibition of
Jia Li et al.
American journal of physiology. Cell physiology, 307(3), C288-C295 (2014-06-13)
Histone deacetylases (HDACs) are a family of enzymes that mediate nucleosomal histone deacetylation and gene expression. Some members of the HDAC family have also been implicated in nonhistone protein deacetylation, which modulates cell-cycle control, differentiation, and cell migration. However, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica