Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU087231

Sigma-Aldrich

MISSION® esiRNA

targeting human BACE1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACATTGCTGCCATCACTGAATCAGACAAGTTCTTCATCAACGGCTCCAACTGGGAAGGCATCCTGGGGCTGGCCTATGCTGAGATTGCCAGGCCTGACGACTCCCTGGAGCCTTTCTTTGACTCTCTGGTAAAGCAGACCCACGTTCCCAACCTCTTCTCCCTGCAGCTTTGTGGTGCTGGCTTCCCCCTCAACCAGTCTGAAGTGCTGGCCTCTGTCGGAGGGAGCATGATCATTGGAGGTATCGACCACTCGCTGTACACAGGCAGTCTCTGGTATACACCCATCCGGCGGGAGTGGTATTATGAGGTGATCATTGTGCGGGTGGAGATCAATGGACAGGATCTGAAAATGGACTGCAAGGAGTACAACTATGACAAGAGCATTGTGGACAGTGGCACCACCAACCTTCGTTTGCCCAAGAAAGTGTT

Ensembl | Número de adesão de ser humano

ENSG00000186318

nº de adesão NCBI

NM_012104

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BACE1(23621) , BACE1(23621)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QHU
QCS
JBS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chi Zhang et al.
Current pharmaceutical biotechnology, 20(1), 56-62 (2019-02-08)
To deliver drugs to treat Alzheimer's Disease (AD), nanoparticles should firstly penetrate through blood brain barrier, and then target neurons. Recently, we developed an Apo A-I and NL4 dual modified nanoparticle (ANNP) to deliver beta-amyloid converting enzyme 1 (BACE1) siRNA.
Nan Zhang et al.
Neuroreport, 31(3), 205-212 (2019-12-27)
Alzheimer's disease is the most common neurodegenerative disease, characterized by accumulation of amyloid β peptides. MicroRNAs have been identified as significant regulators and therapeutic targets of Alzheimer's disease. However, the roles of miR-16-5p and miR-19b-3p and their mechanisms in Alzheimer's
Xiaoyao Zheng et al.
Acta biomaterialia, 49, 388-401 (2016-11-16)
To realize the therapeutic potential of gene drugs for Alzheimer's disease (AD), non-invasive, tissue-specific and efficient delivery technologies must be developed. Here, a hybrid system for amyloid plaques targeted siRNA delivery was formed by PEGylated Poly(2-(N,N-dimethylamino) ethyl methacrylate) (PEG-PDMAEMA) conjugated
Pengzhen Wang et al.
Journal of controlled release : official journal of the Controlled Release Society, 279, 220-233 (2018-04-22)
β-site amyloid precursor protein cleaving enzyme 1 (BACE1) is a key enzyme to cleave the amyloid precursor protein to develop Alzheimer's disease (AD). Reducing BACE1 expression in central neuron through RNA interference technology shows great promise to overcome AD. However
Sujoy Bera et al.
EMBO reports, 21(6), e47954-e47954 (2020-04-24)
Cleavage of amyloid precursor protein (APP) by BACE-1 (β-site APP cleaving enzyme 1) is the rate-limiting step in amyloid-β (Aβ) production and a neuropathological hallmark of Alzheimer's disease (AD). Despite decades of research, mechanisms of amyloidogenic APP processing remain highly

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica