Todas as fotos(1)

Documentos Principais

EHU086641

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human SLC12A9

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

Nível de qualidade

100

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGAACACACTGGCTGCTGTGGTCACTGTCTTCTACCTGGTGGCCTATGCTGCCGTGGACCTGTCCTGCCTGAGCCTGGAGTGGGCCTCGGCCCCCAACTTCCGCCCCACCTTCAGCCTGTTCTCCTGGCACACCTGCCTGCTGGGGGTGGCCTCCTGCCTGCTCATGATGTTCCTCATCAGTCCTGGCGCGGCTGGTGGCTCCCTGCTCCTCATGGGTCTGCTGGCTGCCCTGCTCACCGCGCGAGGAGGCCCCAGTAGCTGGGGCTATGTCAGCCAGGCCTTGCTTTTCCACCAGGTGCGTAAGTATCTGCTTCGGCTGGACGTCCGGAAGGATCACGTGAAGTTCTGGCGGCCCCAGCTGCTGCTCCTGGTGGGGAACCCCCGGGGCGCCCTGCCTCTGCTGCGGTTGGCCAACCAGCTTAAGAAGGGG

Ensembl | Número de adesão de ser humano

ENSG00000146828

nº de adesão NCBI

NM_020246

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SLC12A9(56996) , SLC12A9(56996)

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

MDM2 Antagonists Counteract Drug-Induced DNA Damage.

Anna E Vilgelm et al.

EBioMedicine, 24, 43-55 (2017-10-17)

Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA

Obatoclax induces G1/G0-phase arrest via p38/p21(waf1/Cip1) signaling pathway in human esophageal cancer cells.

Desheng Zhong et al.

Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)

Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle

Cellular senescence checkpoint function determines differential Notch1-dependent oncogenic and tumor-suppressor activities.

S Kagawa et al.

Oncogene, 34(18), 2347-2359 (2014-06-17)

Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica