Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU085021

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAGAAATGGTTGGTTGGTGGTTTTTTTTAGTTTGTATGCCAAGTGAGAAGATGGTATATTTGGTACTGTATTTCCCTCTCATTTTGACCTACTCTCATGCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATAGAACCACTATGAAGCTACCTCAAACTTCCAGTCAGGTAGTTGCAATTGAATTAAATTAGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGAGGCA

Ensembl | Número de adesão de ser humano

ENSG00000164305

nº de adesão NCBI

NM_004346

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CASP3(836) , CASP3(836)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Md Ataur Rahman et al.
Molecules and cells, 39(2), 119-128 (2015-12-18)
Angelica polymorpha Maxim root extract (APRE) is a popular herbal medicine used for treating stomachache, abdominal pain, stomach ulcers, and rheumatism; however the effect of APRE on cancer cells has not yet been explored. Here, we examined APRE cytotoxicity seen
Shan Shi et al.
Molecular medicine reports, 16(6), 9601-9606 (2017-10-19)
Mycoplasma pneumoniae (M. pneumoniae) infection is closely associated with pneumonia in children. Apoptosis of alveolar epithelial cells is involved in the development of pneumonia in children. The present study aimed to examine how caspase‑3 influences apoptosis rates in M. pneumoniae‑infected alveolar epithelial cells.
Chunxi Wang et al.
Cancers, 12(9) (2020-09-17)
T cell receptor (TCR) knockout is a critical step in producing universal chimeric antigen receptor T cells for cancer immunotherapy. A promising approach to achieving the knockout is to deliver the CRISPR/Cas9 system into cells using electrotransfer technology. However, clinical
Behrooz Soltani et al.
Cell biology and toxicology, 32(6), 543-561 (2016-07-31)
Protection against ionizing radiation (IR) and sensitization of cancer cells to IR are apparently contrasting phenomena. However, curcumin takes on these contrasting roles leading to either protection or enhanced apoptosis in different irradiated cells. Here we studied whether pretreatment with
Vijaya Lakshmi Bodiga et al.
Journal of inorganic biochemistry, 153, 49-59 (2015-10-06)
Heart tissue becomes zinc-depleted and the capacity to mobilize labile zinc is diminished, indicating zinc dyshomeostasis during ischemia/reperfusion (I/R). Apparently, zinc pyrithione restores the basal zinc levels during I/R and prevents apoptosis by activating phosphatidyl inositol-3-kinase/Akt and targeting mitochondrial permeability
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica