Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU084801

Sigma-Aldrich

MISSION® esiRNA

targeting human ETS1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Huijie Gao et al.
Cancer letters, 354(2), 427-437 (2014-08-20)
We previously reported that β6 integrin played an important role in the progression of colon cancer. In this study, we demonstrated that β6 integrin induced the expression of MMP-3/MMP-9 and the invasion of colon cancer cells. Moreover, that function was
Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
L Zhang et al.
European review for medical and pharmacological sciences, 23(5), 1986-1995 (2019-03-28)
MicroRNA-338-3p (miR-338-3p) was reported to influence the metastasis and development of several human cancers. However, in bladder cancer (BC), the special function of miR-338-3p remains unknown. Here, we aimed at exploring the miR-338-3p function in the progression of BC. miR-338-3p
X Zhao et al.
European review for medical and pharmacological sciences, 24(1), 181-188 (2020-01-21)
This study aims to detect microRNA-326 expression in nasopharyngeal carcinoma (NPC) tissues and cell lines and to explore the potential mechanism of microRNA-326 inhibiting the proliferative capacity and invasiveness of NPC cells. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was performed
Yutao Yang et al.
Molecular neurobiology, 54(6), 4421-4431 (2016-06-29)
Galanin receptor 2 (GAL2R) is a G protein-coupled receptor for the neuropeptide galanin that regulates many important physiological functions and pathological processes. To investigate the molecular mechanism governing GAL2R gene transcription, the rat GAL2R promoter was isolated and analyzed. We

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica