Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU084671

Sigma-Aldrich

MISSION® esiRNA

targeting human COPS5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCACTGAAACCCGAGTAAATGCTCAGGCTGCTGCATATGAATACATGGCTGCATACATAGAAAATGCAAAACAGGTTGGCCGCCTTGAAAATGCAATCGGGTGGTATCATAGCCACCCTGGCTATGGCTGCTGGCTTTCTGGGATTGATGTTAGTACTCAGATGCTCAATCAGCAGTTCCAGGAACCATTTGTAGCAGTGGTGATTGATCCAACAAGAACAATATCCGCAGGGAAAGTGAATCTTGGCGCCTTTAGGACATACCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATTCCACTTAATAAAATAGAAGATTTTGGTGTACACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCCTCTTTGGATCGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

S Wang et al.
Oncogene, 35(47), 6096-6108 (2016-05-10)
Radiotherapy is the standard therapy for nasopharyngeal carcinoma (NPC); however, radioresistance can hinder successful treatment. Here we report that microRNA (miR)-24 acts as a tumor suppressor and radiosensitizer in NPC cells and xenografts by targeting Jab1/CSN5. Although accumulating evidence has
Yang Liu et al.
Acta pharmaceutica Sinica. B, 10(12), 2299-2312 (2020-12-24)
Programmed cell death-1 (PD-1)/programmed cell death ligand-1 (PD-L1) blocking therapy has become a major pillar of cancer immunotherapy. Compared with antibodies targeting, small-molecule checkpoint inhibitors which have favorable pharmacokinetics are urgently needed. Here we identified berberine (BBR), a proven anti-inflammation
Anja Schwarz et al.
Journal of biomedical science, 24(1), 12-12 (2017-02-09)
Oxidized low-density lipoprotein (oxLDL) mediates the transformation of macrophages (MΦ) to cholesterol-rich foam cells and the release of pro-inflammatory cytokines during atherogenesis. JAB1 (Jun activation domain binding protein-1) is present in all stages of human plaques, involved in the Toll-like
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Michal Meir et al.
Nucleic acids research, 43(9), 4517-4530 (2015-04-10)
The DNA damage response is vigorously activated by DNA double-strand breaks (DSBs). The chief mobilizer of the DSB response is the ATM protein kinase. We discovered that the COP9 signalosome (CSN) is a crucial player in the DSB response and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica