Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU084051

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB10

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACAGGACACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGGAATCCCACAGGATCATTAAACAGCAAGGGCTCGTGGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAATCCAAAGGCATTTGTACTCACACTGTGTCATCACCAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAGGACGACGGGCAGACGTTCTTCAGCCTAGATGACGGGAACACCAAATTCTCTGACCTGATCCAGCTGGTTGACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTGCAAACTCAAGCACCACTGCATCCGAGTGGCCTTATGACCGCAGATGTCCTCTCGGCTGAAGACTGGAGGAAGTGAACACTGGAGTGAAGAAGCGGTCTGTGCGTTGGTGAAGAAC

Ensembl | Número de adesão de ser humano

ENSG00000106070

nº de adesão NCBI

NM_005311

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GRB10(2887) , GRB10(2887)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
EUT
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hui Luo et al.
Frontiers in genetics, 11, 581593-581593 (2020-12-18)
Sertoli cells are central and essential coordinators of spermatogenesis. Accumulating evidence has demonstrated that miRNAs participate in the regulation of Sertoli cell growth. However, the functions and the regulatory mechanisms of miRNAs in Sertoli cells of domestic animals remain largely
Mohammad Imran Khan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 3198-3211 (2018-11-01)
Growth factor receptor-binding protein 10 (GRB10) is a well-known adaptor protein and a recently identified substrate of the mammalian target of rapamycin (mTOR). Depletion of GRB10 increases insulin sensitivity and overexpression suppresses PI3K/Akt signaling. Because the major reason for the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica