Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU083931

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB16

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCACCCCTACGAGTGTGAGTTCTGTGGCAGCTGCTTCCGGGATGAGAGCACACTCAAGAGCCACAAACGCATCCACACGGGTGAGAAACCCTACGAGTGCAATGGCTGTGGCAAGAAGTTCAGCCTCAAGCATCAGCTGGAGACGCACTATAGGGTGCACACAGGTGAGAAGCCCTTTGAGTGTAAGCTCTGCCACCAGCGCTCCCGGGACTACTCGGCCATGATCAAGCACCTGAGAACGCACAACGGCGCCTCGCCCTACCAGTGCACCATCTGCACAGAGTACTGCCCCAGCCTCTCCTCCATGCAGAAGCACATGAAGGGCCACAAGCCCGAGGAGATCCCGCCCGACTGGAGGATAGAGAAGACGTACCTCTACCTGTGCTATGTGTGAAGGGAGGC

Ensembl | Número de adesão de ser humano

ENSG00000109906

nº de adesão NCBI

NM_006006

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ZBTB16(7704) , ZBTB16(7704)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
TBV
XZU
ZYU
OWU
DNS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wencong Song et al.
Journal of cellular biochemistry, 116(10), 2155-2165 (2015-03-27)
The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the
Wencheng Kong et al.
Aging, 12(23), 24009-24022 (2020-11-23)
Peritoneal metastasis (PM) is the main cause of poor prognosis in patients with advanced gastric cancer (GC). Increasing evidence has suggested that cancer-associated EVs in body fluids may assist in the diagnosis and treatment of GC. Here, we investigated the
Yung-Ho Hsu et al.
PloS one, 7(1), e30674-e30674 (2012-02-01)
Many studies suggest that far-infrared (FIR) therapy can reduce the frequency of some vascular-related diseases. The non-thermal effect of FIR was recently found to play a role in the long-term protective effect on vascular function, but its molecular mechanism is
Julien M D Legrand et al.
Nature communications, 10(1), 2278-2278 (2019-05-28)
Mammalian spermatogenesis is sustained by mitotic germ cells with self-renewal potential known as undifferentiated spermatogonia. Maintenance of undifferentiated spermatogonia and spermatogenesis is dependent on tightly co-ordinated transcriptional and post-transcriptional mechanisms. The RNA helicase DDX5 is expressed by spermatogonia but roles

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica