Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU083191

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTGGGTGTGGAACTGGAATTCTCTCTATGTTTGCTGCTAAAGCTGGGGCGAAGAAGGTTCTTGGAGTTGATCAATCTGAAATACTTTACCAGGCAATGGATATTATAAGACTAAATAAACTTGAAGATACTATTACACTAATTAAAGGAAAGATTGAAGAAGTTCATCTTCCTGTAGAAAAAGTAGATGTTATCATATCTGAGTGGATGGGCTATTTTCTTCTGTTTGAGTCTATGTTAGATTCTGTCCTTTATGCAAAGAACAAATACTTGGCAAAAGGAGGCTCGGTCTACCCTGACATTTGCACTATCAGCCTTGTAGCAGTGAGTGATGTGAATAAACATGCTGATAGAATTGCTTTTTGGGATGATGTCTATGGCTTCAAGATGTCCTGCATGAAGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mamta Verma et al.
Communications biology, 4(1), 109-109 (2021-01-27)
Protein arginine methyltransferase 3 (PRMT3) regulates protein functions by introducing asymmetric dimethylation marks at the arginine residues in proteins. However, very little is known about the interaction partners of PRMT3 and their functional outcomes. Using yeast-two hybrid screening, we identified
Zhang Min et al.
Cell death & disease, 10(8), 581-581 (2019-08-06)
Histone arginine methylation, which is catalyzed by protein arginine methyltransferases (PRMTs), plays a key regulatory role in various biological processes. Several PRMTs are involved in skeletal development; however, their role in the osteogenic differentiation of mesenchymal stem cells (MSCs) is

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica