Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU082981

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP6

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGAGCAGAGCGTGAACTACGAAGCATTCCAGAAGACTCAGAGTTAAATACAGTTACATTGCCAAGAAAAGCAAGAATGAAAGACCAGTTTGGCAATTCTATTATCAACACACCTCTGAAACGTCGTAAAGTGTTTTCTCAAGAACCTCCAGATGCTTTAGCTTTAAGCTGCCAAAGTTCCTTTGACAGTGTCATTTTAAACTGTCGAAGTATACGAGTAGGAACACTCTTCCGGCTGTTAATAGAGCCTGTAATTTTTTGTTTAGATTTTATCAAGATACAGCTAGACGAACCAGACCATGATCCTGTAGAGATTATATTAAATACCTCTGATCTAACTAAATGTGAATGGTGTAATGTCCGAAAATTACCTGTAGTGTTTCTTCAAGCAATTCCAGCAGTTTATCAAAAGCTGAGCATCCAACTGCAAATGAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Neil Hattersley et al.
Molecular biology of the cell, 22(1), 78-90 (2010-12-15)
Promyelocytic leukemia protein (PML) is the core component of PML-nuclear bodies (PML NBs). The small ubiquitin-like modifier (SUMO) system (and, in particular, SUMOylation of PML) is a critical component in the formation and regulation of PML NBs. SUMO protease SENP6
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica