Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU081471

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1I2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA

Ensembl | Número de adesão de ser humano

ENSG00000144852

nº de adesão NCBI

NM_022002

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NR1I2(8856) , NR1I2(8856)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X
Wenjing Luo et al.
British journal of pharmacology, 174(8), 700-717 (2017-01-28)
Imatinib mesylate (IM) is a first-line treatment for chronic myeloid leukaemia (CML) as a specific inhibitor of BCR-ABL tyrosine kinase. As IM is widely used in CML, in combination with other drugs, the effects of IM on drug-metabolizing enzymes (DMEs)
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Liming Chen et al.
Molecular pharmacology, 94(1), 749-759 (2018-04-25)
Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at
Yiqiang Xie et al.
Pakistan journal of pharmaceutical sciences, 31(5(Special)), 2315-2321 (2018-11-23)
Feng-Liao-Chang-Wei-Kang (FLCWK), a traditional Chinese patent medicine, consists primarily of Polygonum hydropiper and Daphniphyllum calycinum roots. As a complex containing several kinds of flavonoids, FLCWK has the potential to impact the drug metabolism enzyme P450 3A4 (CYP3A4) and nuclear receptors.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica