Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU079251

Sigma-Aldrich

MISSION® esiRNA

targeting human AIFM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAAAAGCAACTGCACAAGACAACCCCAAATCTGCCACAGAGCAGTCAGGAACTGGTATCCGATCAGAGAGTGAGACAGAGTCCGAGGCCTCAGAAATTACTATTCCTCCCAGCACCCCGGCAGTTCCACAGGCTCCCGTCCAGGGGGAGGACTACGGCAAAGGTGTCATCTTCTACCTCAGGGACAAAGTGGTCGTGGGGATTGTGCTATGGAACATCTTTAACCGAATGCCAATAGCAAGGAAGATCATTAAGGACGGTGAGCAGCATGAAGATCTCAATGAAGTAGCCAAACTATTCAACATTCATGAAGACTGAAGCCCCACAGTGGAATTGGCAAACCCACTGCAGCCCCTGAGAGGAGGTCGAATGGGTAAAGGAGCATTTTTTTATTCAGCAGACTTTCTCTGTGTATGAGTGTGAATGATCAAGTCCTTTGTG

Ensembl | Número de adesão de ser humano

ENSG00000156709

nº de adesão NCBI

NM_145813

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AIFM1(9131) , AIFM1(9131)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mausumi Basu et al.
PLoS pathogens, 13(2), e1006240-e1006240 (2017-02-28)
Oxidative stress activates the cellular kinase HRI, which then phosphorylates eIF2α, resulting in stalled translation initiation and the formation of stress granules (SGs). SG assembly redirects cellular translation to stress response mRNAs and inhibits cap-dependent viral RNA translation. Flavivirus infections
Hongwei Zhao et al.
Cancer letters, 374(1), 136-148 (2016-02-09)
Programmed necrosis is established as a new form of programmed cell death and is emerging as a new strategy of treatment for cancers. Pristimerin is a natural chemical with anti-tumor effect despite the fact that its mechanism remains poorly understood.
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Nan Zhao et al.
Oncotarget, 6(21), 18445-18459 (2015-06-20)
Here we demonstrated that sepantronium bromide (YM155), a survivin suppressant, inhibited esophageal squamous-cell carcinoma (ESCC) growth in mice bearing human ESCC xenografts without affecting body weight. In cell culture, YM155 decreased survivin levels and caused PARP-1 activation, poly-ADP polymer formation

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica