Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU077831

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA9

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCACCCATTGTGATTGTGGAAGATAGAATTCAATTTGAACTCAGGTTGTTTATGAGGGGAAAAAAACAGTTGCATAGAGTATAGCTCTGTAGTGGAATATGTCTTCTGTATAACTAGGCTGTTAACCTATGATTGTAAAGTAGCTGTAAGAATTTCCCAGTGAAATAAAAAAAAATTTTAAGTGTTCTCGGGGATGCATAGATTCATCATTTTCTCCACCTTAAAAATGCGGGCATTTAAGTCTGTCCATTATCTATATAGTCCTGTCTTGTCTATTGTATATATAATCTATATGATTAAAGAAAATATGCATAATCAGACAAGCTTGAATATTGTTTTTGCACCAGACGAACAGTGAGGAAATTCGGAGCTATACATATGTGCAGAAGGTTACTACCTAGGGTTTATGCTTAATTTTAATTGGAGGAAATGAATGCTGA

Ensembl | Número de adesão de ser humano

ENSG00000078399

nº de adesão NCBI

NM_152739

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HOXA9(3205) , HOXA9(3205)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaoping Liu et al.
Placenta, 51, 38-48 (2017-03-16)
Functional placenta formation is crucially dependent on extravillous trophoblast migration and invasion. EPHB4 has been identified to play a negative but important role in regulating trophoblast biological function, whereas the upstream regulation mechanism remains unknown. As reported, there is a
Jun Ni et al.
Journal of receptor and signal transduction research, 39(5-6), 399-406 (2019-12-27)
Purpose: To investigate the possible mechanism of miR-210 involved in epithelial-mesenchymal transition (EMT) of pancreatic cancer cells under hypoxia. Methods: In this study, we used the following approaches. Hypoxic microenvironment was stimulated in vitro, and the CCK-8 assay was used to
Seong-Lan Yu et al.
Molecular carcinogenesis, 55(12), 1915-1926 (2015-11-21)
MicroRNAs (miRNAs) are recognized as crucial posttranscriptional regulators of gene expression, and play critical roles as oncogenes or tumor suppressors in various cancers. Here, we show that miR-196b is upregulated in mesenchymal-like-state non-small cell lung cancer (NSCLC) cells and lung
Yilin Liu et al.
International journal of oncology, 54(5), 1809-1820 (2019-03-01)
Several microRNAs (miRNAs or miRs) that regulate a variety of cancer‑related events are dysregulated in osteosarcoma (OS). An exploration of the specific roles of miRNAs in OS is crucial for the identification of suitable therapeutic targets. Previous studies have shown that

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica