Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU077571

Sigma-Aldrich

MISSION® esiRNA

targeting human BSG

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BSG(682) , BSG(682)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chaoqun Wang et al.
The American journal of pathology, 188(7), 1597-1607 (2018-04-10)
Epithelial-to-mesenchymal transition (EMT) is postulated to be a prerequisite for the establishment of endometriosis (EMS), a common reproductive disorder in women. Our previous studies have demonstrated the elevated expression of transmembrane glycoprotein CD147 and its prosurvival effect on abnormal cells
Tomoki Yoshioka et al.
The American journal of pathology, 189(7), 1338-1350 (2019-04-25)
Podocytes, which are susceptible to injury by various stimuli and stress, are critical regulators of proteinuric kidney diseases, regardless of the primary disease and pathogenesis. We further confirmed a significant correlation between urinary CD147/basigin (Bsg) levels and proteinuria in patients
Yao Meng et al.
Frontiers in cell and developmental biology, 8, 543856-543856 (2020-11-17)
Cancer stem cells (CSCs), responsible for cancer metastasis and recurrence, are generated from non-CSCs after chemo-radiation therapy. This study investigated the induction of CSC potential in non-stem breast cancer cells and the underlying molecular mechanisms in detachment culture. Bulk breast
Adam L Vanarsdall et al.
mBio, 9(3) (2018-05-10)
Human cytomegalovirus (HCMV) replicates in many diverse cell types in vivo, and entry into different cells involves distinct entry mechanisms and different envelope glycoproteins. HCMV glycoprotein gB is thought to act as the virus fusogen, apparently after being triggered by
Baohua Su et al.
Iranian journal of basic medical sciences, 21(8), 806-812 (2018-09-07)
The study aimed to uncover the underlying mechanism linking wear particles to osteoclast differentiation, and we explored the effect of titanium particles of different sizes on CD147 expression and autophagy in macrophages. Effects of titanium particles on CD147 and RANKL

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica