Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU075951

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXW7

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGCAGTCACAGGCAAATGTCTGAGAACATTAGTGGGACATACAGGTGGAGTATGGTCATCACAAATGAGAGACAACATCATCATTAGTGGATCTACAGATCGGACACTCAAAGTGTGGAATGCAGAGACTGGAGAATGTATACACACCTTATATGGGCATACTTCCACTGTGCGTTGTATGCATCTTCATGAAAAAAGAGTTGTTAGCGGTTCTCGAGATGCCACTCTTAGGGTTTGGGATATTGAGACAGGCCAGTGTTTACATGTTTTGATGGGTCATGTTGCAGCAGTCCGCTGTGTTCAATATGATGGCAGGAGGGTTGTTAGTGGAGCATATGATTTTATGGTAAAGGTGTGGGATCCAGAGACTGAAACCTGTCTACACACGTTGCAGGGGCATACTAAT

Ensembl | Número de adesão de ser humano

ENSG00000109670

nº de adesão NCBI

NM_033632

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FBXW7(55294) , FBXW7(55294)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
DCV
XZU
ZYU
BWU
ESU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shusaku Honma et al.
Cancers, 11(5) (2019-05-10)
Although the cancer stem cell (CSC) concept has provided a reasonable explanation for cancer recurrence following chemotherapy, the relationship between CSCs and chemotherapy resistance has not been thoroughly investigated, especially in solid tumors. We aimed to identify the mechanism underlying
Hui Wang et al.
Cancer cell international, 20, 258-258 (2020-06-25)
Cisplatin is widely used as a first-line treatment for non-small cell lung cancer (NSCLC), but chemoresistance remains a major clinical obstacle for efficient use. As a microRNA, miR-223 was reported to promote the doxorubicin resistance of NSCLC. However, whether miR-223
Veronika Reiterer et al.
The EMBO journal, 36(3), 260-273 (2016-12-23)
The F-box protein FBXW7 is the substrate-recruiting subunit of an SCF ubiquitin ligase and a major tumor-suppressor protein that is altered in several human malignancies. Loss of function of FBXW7 results in the stabilization of numerous proteins that orchestrate cell
Jun Shao et al.
Molecular and cellular endocrinology, 498, 110541-110541 (2019-08-16)
MicroRNAs (miRNAs) are small RNAs without protein-coding functions that negatively regulate target genes and play important roles in physiological and pathological processes. The aim of this work was to reveal a novel miRNA/gene pathway in diabetic retinopathy (DR). A microarray
Mariusz L Hartman et al.
Molecular carcinogenesis, 58(4), 588-602 (2018-12-18)
We have extensively studied the phenotypic heterogeneity of patient-derived melanoma cells. Here, whole-exome sequencing revealed novel variants of genes associated with the MAPK, NOTCH, Hippo, cell-cycle, senescence, and ubiquitin-dependent pathways, which could contribute to the observed phenotypic diversity between cell
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica