Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU075051

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCT

Ensembl | Número de adesão de ser humano

ENSG00000142627

nº de adesão NCBI

NM_004431

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EPHA2(1969) , EPHA2(1969)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ACNV
JUU
QCS
IHU
AVT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hee Sung Kim et al.
Scientific reports, 9(1), 3414-3414 (2019-03-06)
Genetically deregulated tumor cells generate vascular channels by vasculogenic mimicry (VM) that is independent of endothelial blood vessels. The morphological characteristics of VM and the role of EphA2 in the formation of VM were evaluated in 144 clinical samples of
Qiaoli Wu et al.
Biochemical and biophysical research communications, 503(4), 2436-2442 (2018-07-04)
MiR-124-3p and EphA2 are aberrantly expressed in glioma tissue specimens. In the present study, we firstly investigated that miR-124-3p inhibits EphA2 expression mediated by binding its 3'-UTR to regulate the progression of human glioma. The U87MG and LN229 cells were transfected
Xin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5495-5509 (2019-01-23)
The balance of myogenic and adipogenic differentiation is crucial for skeletal muscle homeostasis. Given the vital role of membrane proteins (MBPs) in cell signal perception, membrane proteomics was conducted to delineate mechanisms regulating differentiation of adipogenic and myogenic precursors in
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Marc Swidergall et al.
PLoS pathogens, 17(1), e1009221-e1009221 (2021-01-21)
During oropharyngeal candidiasis (OPC), Candida albicans invades and damages oral epithelial cells, which respond by producing proinflammatory mediators that recruit phagocytes to foci of infection. The ephrin type-A receptor 2 (EphA2) detects β-glucan and plays a central role in stimulating
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica