Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU072991

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CACACCCTGCATATCATAATGGGGGTAAAGTTAAGTTGAGATAGTTTTCATCCATAACTGAACATCCAAAATCTTGATCAGTTAAGAAATTTCACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGCATGGGATTATTAGAATCAAACATTTTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACTCTATTCTTTAACTCCCATTACCATGTAATGGCAGTTATATTTTGCAGTTCCCACATTAAAGAAGACCTGAGAATGTATCCCCAAAAGCGTGAGCTTAAAATACAAGACTGCCATATTAAATTTTTTGTTGACATTAGTCTCAGTGAAGACTATGAAAATGCTGGCTATAGATGTCTTTTCC

Ensembl | Número de adesão de ser humano

ENSG00000189403

nº de adesão NCBI

NM_002128

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HMGB1(3146) , HMGB1(3146)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Minghua Yang et al.
Autophagy, 11(2), 214-224 (2015-01-22)
Both apoptosis ("self-killing") and autophagy ("self-eating") are evolutionarily conserved processes, and their crosstalk influences anticancer drug sensitivity and cell death. However, the underlying mechanism remains unclear. Here, we demonstrated that HMGB1 (high mobility group box 1), normally a nuclear protein
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica