Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU072741

Sigma-Aldrich

MISSION® esiRNA

targeting human RORA

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTGCCTTTGACTCTCAGAACAACACCGTGTACTTTGATGGGAAGTATGCCAGCCCCGACGTCTTCAAATCCTTAGGTTGTGAAGACTTTATTAGCTTTGTGTTTGAATTTGGAAAGAGTTTATGTTCTATGCACCTGACTGAAGATGAAATTGCATTATTTTCTGCATTTGTACTGATGTCAGCAGATCGCTCATGGCTGCAAGAAAAGGTAAAAATTGAAAAACTGCAACAGAAAATTCAGCTAGCTCTTCAACACGTCCTACAGAAGAATCACCGAGAAGATGGAATACTAACAAAGTTAATATGCAAGGTGTCTACCTTAAGAGCCTTATGTGGACGACATACAGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTTCATTTTCCTCCATTATACAAGGAGTTGTTCACTTCAGAATTTGAGCCAGCAATGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hongyu Li et al.
Journal of cellular physiology, 233(1), 641-650 (2017-03-24)
Low O2 pressures present in the microenvironment of epidermis control keratinocyte differentiation and epidermal barrier function through hypoxia inducible factors (HIFs) dependent gene expression. This study focuses on investigating relations of the retinoic acid receptor-related orphan receptor alpha (RORα) to
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Marie R Webster et al.
Pigment cell & melanoma research, 28(2), 184-195 (2014-11-20)
We have previously shown that Wnt5A drives invasion in melanoma. We have also shown that Wnt5A promotes resistance to therapy designed to target the BRAF(V600E) mutation in melanoma. Here, we show that melanomas characterized by high levels of Wnt5A respond

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica