Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU072661

Sigma-Aldrich

MISSION® esiRNA

targeting human MLKL

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGACACATCCCACTCCAAATGATATTTCCAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCTCTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGCTGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTTTCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGAATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGCTAACACATGAATGAGGCCAATCAAGACCAG

Ensembl | Número de adesão de ser humano

ENSG00000168404

nº de adesão NCBI

NM_152649

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MLKL(197259) , MLKL(197259)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chengkui Yang et al.
Cell death & disease, 8(10), e3084-e3084 (2017-10-06)
Receptor-interacting kinase-3 (RIP3) is a key regulator of necroptosis. It has been shown that the expression of RIP3 is silenced in most cancer cells and tissues due to genomic methylation. However, the regulatory mechanisms controlling RIP3 expression in cancer cells
Piotr T Filipczak et al.
Cancer research, 76(24), 7130-7139 (2016-10-21)
Tuberous sclerosis complex (TSC) is a genetic multiorgan disorder characterized by the development of neoplastic lesions in kidney, lung, brain, heart, and skin. It is caused by an inactivating mutation in tumor suppressor genes coding the TSC1/TSC2 complex, resulting in
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
Yu Xiong et al.
Cell death and differentiation, 26(10), 1929-1941 (2019-01-16)
Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica