Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU072201

Sigma-Aldrich

MISSION® esiRNA

targeting human LONP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAGCAATGAGTCGGATGTGGTCGAGAGCCTGGATGAAATCTACCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTTGGGGACAAGCTGCGCATGATCGTCATGGGACACAGAAGAGTCCATATCAGCAGACAGCTGGAGGTGGAGCCCGAGGAGCCGGAGGCGGAGAACAAGCACAAGCCCCGCAGGAAGTCAAAGCGGGGCAAGAAGGAGGCGGAGGACGAGCTGAGCGCCAGGCACCCGGCGGAGCTGGCGATGGAGCCCACCCCTGAGCTCCCGGCTGAGGTGCTCATGGTGGAGGTAGAGAACGTTGTCCACGAGGACTTCCAGGTCACGGAGGAGGTGAAAGCCCTGACTGCAGAGATCGTGAAGACCATCCGGGACATCATTGCCTTGAACCC

Ensembl | Número de adesão de ser humano

ENSG00000196365

nº de adesão NCBI

NM_004793

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LONP1(9361) , LONP1(9361)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ADV
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Olga Zurita Rendón et al.
Molecular and cellular biology, 38(20) (2018-08-01)
LONP1, an AAA+ mitochondrial protease, is implicated in protein quality control, but its precise role in this process remains poorly understood. In this study, we have investigated the role of human LONP1 in mitochondrial proteostasis and gene expression. Depletion of
Shiyuan Huang et al.
American journal of physiology. Cell physiology, 319(6), C1020-C1028 (2020-09-17)
Myoblast differentiation is a crucial process for myogenesis. Mitochondria function as an energy-providing machine that is critical to this process, and mitochondrial dysfunction can prevent myoblasts from fusing into myotubes. However, the molecular mechanisms underlying the dynamic regulation of mitochondrial
Marie Lagouge et al.
PLoS genetics, 11(8), e1005423-e1005423 (2015-08-08)
We have studied the in vivo role of SLIRP in regulation of mitochondrial DNA (mtDNA) gene expression and show here that it stabilizes its interacting partner protein LRPPRC by protecting it from degradation. Although SLIRP is completely dependent on LRPPRC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica